GENERAL

Functional Genomics of Tick Vectors Challenged with the Cattle Parasite Babesia bigemina

Mar 17, 2017 by in GENERAL Comments Off on Functional Genomics of Tick Vectors Challenged with the Cattle Parasite Babesia bigemina

© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_32 32. Functional Genomics of Tick Vectors Challenged with the Cattle…

read more

Impact of Next-Generation Technologies on Exploring Socioeconomically Important Parasites and Developing New Interventions

Mar 17, 2017 by in GENERAL Comments Off on Impact of Next-Generation Technologies on Exploring Socioeconomically Important Parasites and Developing New Interventions

Description 454/Roche Illumina/Solexa SOLiD Platform Genome Sequencer FLX Genome Analyzer IIx SOLiD 3 Plus System Sequencing method Emulsion PCR of bead-bound oligos Isothermal bridge amplification on flow cell Emulsion PCR…

read more

Nested and Multiplex Real-Time PCR Using Dual-Labeled Probes: Detecting and Discriminating Mycobacterium tuberculosis Complex Members in Cultures and Animal Tissues

Mar 17, 2017 by in GENERAL Comments Off on Nested and Multiplex Real-Time PCR Using Dual-Labeled Probes: Detecting and Discriminating Mycobacterium tuberculosis Complex Members in Cultures and Animal Tissues

Primer/probe Sequence (5′–3′) Complementary target F_Actin GGC TCY ATY CTG GCC TC β–actin gene of mammalsa R_Actin GCA YTT GCG GTG SAC RAT G  P_Actinb Cy5.5-TAC TCC TGC TTG CTG…

read more

Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species

Mar 17, 2017 by in GENERAL Comments Off on Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species

Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199  Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384  Bruce11 Fw:…

read more

Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in Poultry Flocks by Restriction Fragment Length Polymorphism (RFLP) Analysis

Mar 17, 2017 by in GENERAL Comments Off on Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in Poultry Flocks by Restriction Fragment Length Polymorphism (RFLP) Analysis

© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…

read more
Get Clinical Tree app for offline access