Fig. 1 Illustration of the real-time monitoring and alarm system of the IZSLER Veterinary Biobank facility 3 Sample Types and Preparation Pre-analytical conditions are a key factor in maintaining the…
Fig. 1 General workflow and timeline of the Mycoplasma and Chlamydia assays Validated protocols for differentiation among 37 Mollicutes species [10] and nine Chlamydia spp. [28] have been published by…
Fig. 1 ASFV viral DNA digested with restriction enzyme. (a) Lane 1: DNA ladder. Lane 2: two microliters (400 ng) of non-digested ASFV viral DNA. (b) Lane 1: DNA ladder….
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_32 32. Functional Genomics of Tick Vectors Challenged with the Cattle…
Fig. 1 Generic location of the six segments in the target DNA used to design LAMP primers. Forward (F3) and backward (B3) outer primers and forward (FIP) and backward (BIP)…
Description 454/Roche Illumina/Solexa SOLiD Platform Genome Sequencer FLX Genome Analyzer IIx SOLiD 3 Plus System Sequencing method Emulsion PCR of bead-bound oligos Isothermal bridge amplification on flow cell Emulsion PCR…
Primer/probe Sequence (5′–3′) Complementary target F_Actin GGC TCY ATY CTG GCC TC β–actin gene of mammalsa R_Actin GCA YTT GCG GTG SAC RAT G P_Actinb Cy5.5-TAC TCC TGC TTG CTG…
Locus/genea Primer Sequence (5′ to 3′)b MgCl2 (mM)c Size of PCR product (bp) Location of the sequence used to define MLST locusd, e Size of MLST locus (bp)d adk adkF…
Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199 Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384 Bruce11 Fw:…
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…
