Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species


Multiplex PCR mixa

Locus

Primer sequences (5′-3′)b

Allele size range (bp)c

M1

Bruce30

Fw: PET – TGACCGCAAAACCATATCCTTC

Rw: TATGTGCAGAGCTTCATGTTCG

119–199
 
Bruce08

Fw: PET – ATTATTCGCAGGCTCGTGATTC

Rw: ACAGAAGGTTTTCCAGCTCGTC

312–384
 
Bruce11

Fw: 6FAM – CTGTTGATCTGACCTTGCAACC

Rw: CCAGACAACAACCTACGTCCTG

257–1076
 
Bruce45

Fw: 6FAM – ATCCTTGCCTCTCCCTACCAG

Rw: CGGGTAAATATCAATGGCTTGG

133–187
 
Bruce19

Fw: NED – GACGACCCGGACCATGTCT

Rw: ACTTCACCGTAACGTCGTGGAT

79–205

M2

Bruce06

Fw: NED – GATTGCGGAACGTCTGAACT

Rw: TAACCGCCTTCCACATAATCG

312–714
 
Bruce42

Fw: VIC – CATCGCCTCAACTATACCGTCA

Rw: ACCGCAAAATTTACGCATCG

164–914

M3

Bruce12

Fw: NED – CGGTAAATCAATTGTCCCATGA

Rw: GCCCAAGTTCAACAGGAGTTTC

302–452
 
Bruce18

Fw: PET – TATGTTAGGGCAATAGGGCAGT

Rw: GATGGTTGAGAGCATTGTGAAG

130–186
 
Bruce55

Fw: PET – TCAGGCTGTTTCGTCATGTCTT

Rw: AATCTGGCGTTCGAGTTGTTCT

193–553
 
Bruce21

Fw: 6FAM – CTCATGCGCAACCAAAACA

Rw: GTGGATACGCTCATTCTCGTTG

431–463
 
Bruce04

Fw: VIC – CTGACGAAGGGAAGGCAATAAG

Rw: TGGTTTTCGCCAATATCAACAA

313–473

M4

Bruce07

Fw: NED – GCTGACGGGGAAGAACATCTAT

Rw: ACCCTTTTTCAGTCAAGGCAAA

134–246
 
Bruce09

Fw: VIC – GCGGATTCGTTCTTCAGTTATC

Rw: GGGAGTATGTTTTGGTTGTACATAG

124–292
 
Bruce43

Fw: 6FAM – TCTCAAGCCCGATATGGAGAAT

Rw: TATTTTCCGCCTGCCCATAAAC

170–194
 
Bruce16

Fw: 6FAM – ACGGGAGTTTTTGTTGCTCAAT

Rw: GGCCATATCCTTCCGCAATA

227–353


aFor primer mixes including the forward primers targeting the Bruce18, Bruce42, and Bruce55 loci, equal concentrations of both labelled and unlabelled primers targeting these loci were added to the mix in order to avoid the posterior production of excessive fluorescence during the capillary electrophoresis [6]

bFw, forward primer; Rw, reverse primer

cExpected allele size ranges are given in base pairs. The test has been designed so that fragments would differ from one another by either size, fluorescence, or both, to exclude the possibility of overlap in capillary electrophoresis results




 


6.

10× forward primer mixes (M1fw, M2fw, M3fw, and M4fw mixes) (see Note 1 ):

(a)

M1fw: Mix and dilute 4.4 μl of each 50 μM primer stock solutions [“Bruce08 Fw (PET labelled),” “Bruce11 Fw (6FAM labelled),” “Bruce45 Fw (6FAM labelled),” “Bruce30 Fw (PET labelled),” and “Bruce19 Fw (NED labelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 2 μM (10×) primer mix working solution (see Note 2 ).

 

(b)

M2fw: Mix and dilute 50 μM primer stock solutions [8.8 μl of “Bruce06 Fw (NED labelled),” 1.1 μl of “Bruce42 Fw (VIC labelled),” and 1.1 μl of “Bruce42 Fw (unlabelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 4.0, 0.5, and 0.5 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

(c)

M3fw: Mix and dilute 50 μM primer stock solutions [3.3 μl of “Bruce12 Fw (NED labelled),” 1.1 μl of “Bruce55 Fw (PET labelled),” 1.1 μl of “Bruce55 Fw (unlabelled),” 1.1 μl of “Bruce18 Fw (PET labelled),” 1.1 μl of “Bruce18 Fw (unlabelled),” 4.4 μl of “Bruce21 Fw (6FAM labelled),” and 4.4 μl of “Bruce04 Fw (VIC labelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 1.5, 0.5, 0.5, 0.5, 0.5, 2.0, and 2.0 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

(d)

M4fw: Mix and dilute 50 μM primer stock solutions [3.3 μl of “Bruce07 Fw (NED labelled),” 4.4 μl of “Bruce09 Fw (VIC labelled),” 4.4 μl of “Bruce16 Fw (6FAM labelled),” and 3.3 μl of “Bruce43 Fw (6FAM labelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 1.5, 2.0, 2.0, and 1.5 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

 

7.

10× reverse primer mixes (M1rw, M2rw, M3rw, and M4rw mixes) (see Note 1 ).

(a)

M1rw: Mix and dilute 4.4 μl of each 50 μM primer stock solutions [“Bruce08 Rw (unlabelled),” “Bruce11 Rw (unlabelled),” “Bruce45 Rw (unlabelled),” “Bruce30 Rw (unlabelled),” and “Bruce19 Rw (unlabelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 2 μM (10×) primer mix working solution (see Note 2 ).

 

(b)

M2rw: Mix and dilute 50 μM primer stock solutions [8.8 μl of “Bruce06 Rw (unlabelled)” and 2.2 μl of “Bruce42 Rw (unlabelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 4.0 and 1.0 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

(c)

M3rw: Mix and dilute 50 μM primer stock solutions [3.3 μl of “Bruce12 Rw (unlabelled),” 2.2 μl of “Bruce55 Rw (unlabelled),” 2.2 μl of “Bruce18 Rw (unlabelled),” 4.4 μl of “Bruce21 Rw (unlabelled),” and 4.4 μl of “Bruce04 Rw (unlabelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 1.5, 1.0, 1.0, 2.0, and 2.0 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

(d)

M4rw: Mix and dilute 50 μM primer stock solutions [3.3 μl of “Bruce07 Rw (unlabelled),” 4.4 μl of “Bruce09 Rw (unlabelled),” 4.4 μl of “Bruce16 Rw (unlabelled),” and 3.3 μl of “Bruce43 Rw (unlabelled)”] in a final volume of 110 μl of TE buffer or Mol Bio grade water to obtain a 1.5, 2.0, 2.0, and 1.5 μM (10×) primer mix working solution, respectively (see Note 2 ).

 

 

8.

Hi-Di formamide.

 

9.

POP-7 polymer, a separation matrix for performing DNA sequencing and fragment analysis on the Applied Biosystems genetic analyzer instruments (Life Technologies, USA).

 

10.

Anode and cathode buffers, reagents to support electrophoresis on Applied Biosystems genetic analyzer instruments (Life Technologies, USA).

 

11.

GeneScan 1200 LIZ size standard (Life Technologies, USA).

 

12.

DNA samples from one or more reference strains having known MLVA profiles, for comparison (e.g., B. melitensis biovar 1 strain 16 M). Be sure to use purified DNAs (A260/A280 ratio ≥1.8).

 

13.

DNA samples to be tested. Be sure to use purified DNAs (A260/A280 ratio ≥1.8).

 





2.3 Equipment and Instruments




1.

PCR plate cooling block or ice.

 

2.

Complete “clean set” (1,000 μl, 200 μl, 100 μl, 20 μl, and 10 μl) of single-channel pipettes for PCR master mix setup.

 

3.

10 μl single-channel pipettes for DNA solutions.

 

4.

8-channel pipettes (200 μl and 10 μl) for DNA solutions.

 

5.

Thermocycler with heated lid.

 

6.

Heat block (or thermocycler), capable of operating at 95 °C.

 

7.

Centrifuge and rotors adapted to 0.2 ml PCR tubes, 1.5 ml microcentrifuge tubes, and 96-well v-bottom PCR plates.

 

8.

Mixer.

 

9.

Capillary electrophoresis genetic analyzer (e.g., we use ABI PRISM genetic analyzer, either 3130 or 3500 series) (Life Technologies, USA) (see Note 3 ).

 

10.

Capillary arrays, 50 cm.

 


2.4 Software




1.

Data collection software, the operative software to drive the Applied Biosystems genetic analyzer instruments.

 

2.

GeneMapper 4.1 (Life Technologies, USA).

 



3 Methods



3.1 PCR Setup




1.

Defrost all PCR components and keep them on ice during preparation.

 

2.

Briefly vortex and spin down the primer mixes in their amber tubes.

 

3.

Place a 96-well v-bottom PCR plate or the required number of 0.2 ml PCR tubes in a PCR block or on ice.

 

4.

Mark four 1.5 ml microcentrifuge tubes as M1, M2, M3, and M4, respectively, for each of the four multiplex master mixes to be prepared.

 

5.

Prepare each master mix in the correspondent 1.5 ml microcentrifuge tube using the appropriate volumes (see Table 2), preferably introducing them in the following order: Mol Bio water, Q solution, 2× Type-it microsatellite PCR Master Mix, and primers.


Table 2
PCR master mixes composition








































Component

Volume per reaction (μl)a

Final concentration

2× Type-it microsatellite PCR Master Mix

 5


Q solution

 1

0.5×

10× forward primer mixb

 1


10× reverse primer mixb

 1


Mol Bio grade water

 1


DNA template solution

 1

10–50 ng

Final volume (μl)

10



aThe volume of each component to add to the master mix corresponds to the volume per reaction of that component multiplied by the total number of samples (including any positive and negative controls) plus 10 % of the original volume to compensate for eventual pipetting losses (DNA template solutions are not added to master mixes)

bPrimer mix for the specific multiplex PCR being prepared, primer solutions should be paired as follows: M1fw and M1rw (for multiplex master mix 1—M1), M2fw and M2rw (for multiplex master mix 2—M2), M3fw and M3rw (for multiplex master mix 3—M3), and M4fw and M4rw (for multiplex master mix 4—M4)

 

6.

Vortex the master mixes for 1–2 s.

 

7.

Leave the DNA clean room.

 

8.

To optimize the workflow and facilitate the dispensation of DNA samples, it is useful to include 32 samples in each PCR run: 28 DNA samples to be tested, two positive reference DNA samples for positive controls, and two no-template negative controls.

 

9.

Due to differences in the PCR cycling conditions, the M2 PCR should be run separately from M1, M3, and M4 PCRs.

 

10.

In a single 96-well plate or tube rack, dispense M1, M3, and M4 master mixes: 9 μl of each master mix in each well/tube, for each sample to be tested, dedicating distinct columns to each kind of master mix. Using a multichannel pipette, add 1 μl of each DNA sample (1–50 ng) to each master mix, keeping row positions constant across columns.

 

11.

In a separate 96-well plate or tube rack, dispense 9 μl of M2 master mix in each well/tube for each sample to be tested. Using a multichannel pipette, add 1 μl of each DNA sample (1–50 ng) to the master mix, keeping row positions constant across columns.

 

12.

Keep the plates/racks on ice.

 

13.

Run the PCRs under the following thermocycling conditions: initial activation step at 95 °C for 5 min followed by 30 cycles (for M1, M3, and M4 PCRs) or 26 cycles (for M2 PCR) of denaturation (at 95 °C for 30 s), annealing (at 60 °C for 90 s) and extension (at 72 °C for 30 s) steps, and a final extension step at 60 °C for 45 min and 20 °C for 120 min. Keep the products at 4 °C after the amplification reactions.

 

Mar 17, 2017 | Posted by in GENERAL | Comments Off on Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species
Premium Wordpress Themes by UFO Themes