Multilocus Sequence Typing (MLST): Markers for the Traceability of Pathogenic Leptospira Strains


Locus/genea

Primer

Sequence (5′ to 3′)b

MgCl2 (mM)c

Size of PCR product (bp)

Location of the sequence used to define MLST locusd, e

Size of MLST locus (bp)d

adk

adkF

GGGCTGGAAAAGGTACACAA

(alternative: ACATTATCTTCATGGGACCTCC) f

1.5

531

557

3458789–3458361

429
 
adkR

ACGCAAGCTCCTTTTGAATC

(alternative: TTACACAAGCTCCCTTTGAAT) f
    
icdA

icdAF

GGGACGAGATGACCAGGAT

1.5

674

3980926–3980372

555
 
icdAR

TTTTTTGAGATCCGCAGCTTT

(alternative: CTTTTTTGAGATCTCCGGCTTT) f
 
674
  
lipL41

LipL41F

TAGGAAATTGCGCAGCTACA

1.5

520

3603644–3604120

477
 
LipL41R

GCATCGAGAGGAATTAACATCA
    
rrs

rrsF

CATGCAAGTCAAGCGGAGTA

1.5

541

1862535–1862984

450
 
rrsR

AGTTGAGCCCGCAGTTTTC
    
secY

secYF

ATGCCGATCATTTTTGCTTC

1.5

549

3459402–3458902

501
 
secYR

CCGTCCCTTAATTTTAGACTTCTTC

(alternative: CCTTCCTTTAATTTTAGACTTTTTC) f
 
548
  
lipL32

LipL32F

ATCTCCGTTGCACTCTTTGC

1.5

474

1667072–166641

432
 
LipL32R

ACCATCATCATCATCGTCCA
    

a adk (adenylate kinase), icdA (isocitrate dehydrogenase), lipL41 (outer membrane lipoprotein LipL41), rrs (16S rRNA), secY (preprotein translocase SecY protein), and lipL32 (outer membrane lipoprotein LipL32)

bOriginal primers according to Ahmed et al. [1] and additional alternative primers for some loci according to Ahmed et al. [5]

cConcentration of MgCl2 in the PCR mixture as adjusted for each primer pair

dThe location of the sequence used to define MLST locus and the size of MLST locus (bp) as modified in Ahmed et al. [5]

eNucleotide positions based in the published genome sequence of L. interrogans serovar Copenhageni strain Fiocruz L1-130 chromosome I (GenBank Accession Number AE016823)

fWhen using these alternative primers, the annealing temperature should be adjusted to 54 °C in the PCR cycling conditions




Table 2
Loci and respective flanking oligonucleotide primers for the Leptospira 7 L MLST scheme




































































































































Locus/genea

Primer

Sequence (5′ to 3′)b

MgCl2 (mM)c

Size of PCR product (bp)

Location of MLST locusd

Size of MLST locus (bp)

glmU

glmU-FM

AGGATAAGGTCGCTGTGGTA

1.5

650

3784955–3784512

444
 
glmU-RM

AGTTTTTTTCCGGAGTTTCT
       

pntA

pntA-FM

TAGGAAARATGAAACCRGGAAC

1.5

621

56347–56871

525
 
pntA-RM

AAGAAGCAAGATCCACAAYTAC
       

sucA

sucA-FM

TCATTCCACTTYTAGATACGAT

2.5

640

1227474–1227920

447
 
sucA-RM

TCTTTTTTGAATTTTTGACG
       

tpiA

tpiA-FM

TTGCAGGAAACTGGAAAATGAAT

3.5

639

1694673–1694248

426
 
tpiA-RM

GTTTTACRGAACCHCCGTAGAGAAT
       

pfkB

pfkB-FM

CGGAGAGTTTTATAARAAGGACAT

1.5

588

1386553–1386984

432
 
pfkB-RM

AGAACACCCGCCGCAAAACAAT
       

mreA

mreA-FM

GGCTCGCTCTYGACGGAAA

2.0

719

2734550–2734116

435
 
mreA-RM

TCCRTAACTCATAAAMGACAAAGG
       

caiB

caiB-F

CAACTTGCGGAYATAGGAGGAG

1.5

650

1562845–1563246

402
 
caiB-R

ATTATGTTCCCCGTGAYTCG
       


a glmU (UDP-N-acetylglucosamine pyrophosphorylase), pntA (NADP transhydrogenase subunit alpha), sucA (2-oxoglutarate dehydrogenase decarboxylase component), tpiA (triosephosphate isomerase), pfkB (ribokinase), mreA (rod-shape-determining protein rodA), and caiB (carnitine dehydratase)

bPrimers according to Boonsilp et al. [4]

cConcentration of MgCl2 in the PCR mixture as adjusted for each primer pair

dNucleotide positions based in the published genome sequence of L. interrogans serovar Lai strain 56601 chromosome I (GenBank Accession Number NC004342)



 


2.

Reagents for conventional PCR reactions: DNA polymerase enzyme and respective 10× buffer, MgCl2 (25 mM), dNTPs (25 mM), and distilled PCR grade water.

 

3.

Negative (sample without added DNA from leptospires) and positive (sample spiked with leptospiral DNA approximating 20 ng genomic DNA per reaction) PCR reaction controls.

 

4.

PCR thermocycler.

 

5.

Tris-borate EDTA (TBE) buffer (pH 8.0): 50 mM Tris, 50 mM boric acid, 0.5 mM EDTA.

 

Only gold members can continue reading. Log In or Register to continue

Mar 17, 2017 | Posted by in GENERAL | Comments Off on Multilocus Sequence Typing (MLST): Markers for the Traceability of Pathogenic Leptospira Strains
Premium Wordpress Themes by UFO Themes