Locus/genea Primer Sequence (5′ to 3′)b MgCl2 (mM)c Size of PCR product (bp) Location of the sequence used to define MLST locusd, e Size of MLST locus (bp)d adk adkF…
Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199 Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384 Bruce11 Fw:…
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…
Fig. 1 Biosafety management program core elements The purpose of the Biosafety Program is to prevent or minimize employee exposures or the accidental environmental release of hazardous biological agents through…
Agent Genotyping method References Bacillus anthracis VNTR/MLVA [91–93] SNP analysis [94, 95] Borrelia spp. PCR-RFLP subtyping (ospA) [54, 96] MLST [97] Brucella spp. SNP analysis [98] B. abortus, B. suis,…
Target pathogen(s) POC Amplification method LOD or sensitivity References Yes No African swine fever virus × LAMP ≤330 copies [67] Avian influenza virus (H5N1) × RT-PCR – [10] Avian influenza…
Fig. 1 Schematic representation of the RLB hybridization process. (a) Oligoprobes are covalently coupled to the membrane in lines using a line-blotter apparatus; (b) the membrane is then rotated 90°;…
Fig. 1 Mycobacterium bovis cells captured by monoclonal antibody and biotinylated 12-mer peptide-coated Dynabeads® MyOne™ Tosylactivated—a large clump of M. bovis cells and an individual cell are clearly seen attached…
Fig. 1 Step-by-step protocol for the molecular diagnosis of strongylid nematode infections from small ruminant fecal samples. Following coproscopy (1). the fecal suspension is washed and nematode parasite eggs are…
Oligo name Sequence (5′–3′) Working concentration (μM) Primer Hofm_BTV_IVI_F2 TGG AYA AAG CRA TGT CAA A 20 Primer Hofm_BTV_IVI_R2 ACR TCA TCA CGA AAC GCT TC 20 Probe Hofm_BTV_IVI_Pa FAM-ARG…
