Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species

Mar 17, 2017 by in GENERAL Comments Off on Multiple-Locus Variable-Number Tandem Repeat (VNTR) Analysis (MLVA) Using Multiplex PCR and Multicolor Capillary Electrophoresis: Application to the Genotyping of Brucella Species

Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199  Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384  Bruce11 Fw:…

read more

Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in Poultry Flocks by Restriction Fragment Length Polymorphism (RFLP) Analysis

Mar 17, 2017 by in GENERAL Comments Off on Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in Poultry Flocks by Restriction Fragment Length Polymorphism (RFLP) Analysis

© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…

read more
Get Clinical Tree app for offline access