Primer/probe Sequence (5′–3′) Complementary target F_Actin GGC TCY ATY CTG GCC TC β–actin gene of mammalsa R_Actin GCA YTT GCG GTG SAC RAT G P_Actinb Cy5.5-TAC TCC TGC TTG CTG…
Locus/genea Primer Sequence (5′ to 3′)b MgCl2 (mM)c Size of PCR product (bp) Location of the sequence used to define MLST locusd, e Size of MLST locus (bp)d adk adkF…
Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199 Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384 Bruce11 Fw:…
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…
Target pathogen(s) POC Amplification method LOD or sensitivity References Yes No African swine fever virus × LAMP ≤330 copies [67] Avian influenza virus (H5N1) × RT-PCR – [10] Avian influenza…
Agent Genotyping method References Bacillus anthracis VNTR/MLVA [91–93] SNP analysis [94, 95] Borrelia spp. PCR-RFLP subtyping (ospA) [54, 96] MLST [97] Brucella spp. SNP analysis [98] B. abortus, B. suis,…
Fig. 1 Biosafety management program core elements The purpose of the Biosafety Program is to prevent or minimize employee exposures or the accidental environmental release of hazardous biological agents through…
Fig. 1 Schematic representation of the RLB hybridization process. (a) Oligoprobes are covalently coupled to the membrane in lines using a line-blotter apparatus; (b) the membrane is then rotated 90°;…
Fig. 1 Mycobacterium bovis cells captured by monoclonal antibody and biotinylated 12-mer peptide-coated Dynabeads® MyOne™ Tosylactivated—a large clump of M. bovis cells and an individual cell are clearly seen attached…
Fig. 1 Step-by-step protocol for the molecular diagnosis of strongylid nematode infections from small ruminant fecal samples. Following coproscopy (1). the fecal suspension is washed and nematode parasite eggs are…
