Fig. 1 General workflow and timeline of the Mycoplasma and Chlamydia assays Validated protocols for differentiation among 37 Mollicutes species [10] and nine Chlamydia spp. [28] have been published by…
Fig. 1 Generic location of the six segments in the target DNA used to design LAMP primers. Forward (F3) and backward (B3) outer primers and forward (FIP) and backward (BIP)…
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_32 32. Functional Genomics of Tick Vectors Challenged with the Cattle…
Description 454/Roche Illumina/Solexa SOLiD Platform Genome Sequencer FLX Genome Analyzer IIx SOLiD 3 Plus System Sequencing method Emulsion PCR of bead-bound oligos Isothermal bridge amplification on flow cell Emulsion PCR…
Primer/probe Sequence (5′–3′) Complementary target F_Actin GGC TCY ATY CTG GCC TC β–actin gene of mammalsa R_Actin GCA YTT GCG GTG SAC RAT G P_Actinb Cy5.5-TAC TCC TGC TTG CTG…
Locus/genea Primer Sequence (5′ to 3′)b MgCl2 (mM)c Size of PCR product (bp) Location of the sequence used to define MLST locusd, e Size of MLST locus (bp)d adk adkF…
Multiplex PCR mixa Locus Primer sequences (5′-3′)b Allele size range (bp)c M1 Bruce30 Fw: PET – TGACCGCAAAACCATATCCTTC Rw: TATGTGCAGAGCTTCATGTTCG 119–199 Bruce08 Fw: PET – ATTATTCGCAGGCTCGTGATTC Rw: ACAGAAGGTTTTCCAGCTCGTC 312–384 Bruce11 Fw:…
© Springer Science+Business Media New York 2015Mónica V. Cunha and João Inácio (eds.)Veterinary Infection Biology: Molecular Diagnostics and High-Throughput StrategiesMethods in Molecular BiologyMethods and Protocols124710.1007/978-1-4939-2004-4_22 22. Characterization of Campylobacter jejuni and Campylobacter coli Genotypes in…
Fig. 1 Biosafety management program core elements The purpose of the Biosafety Program is to prevent or minimize employee exposures or the accidental environmental release of hazardous biological agents through…
Agent Genotyping method References Bacillus anthracis VNTR/MLVA [91–93] SNP analysis [94, 95] Borrelia spp. PCR-RFLP subtyping (ospA) [54, 96] MLST [97] Brucella spp. SNP analysis [98] B. abortus, B. suis,…
