Cost is an important issue for all diagnostic assays. In this respect, high-resolution DNA melting analysis (HRM) has become an attractive real-time technology. HRM techniques can determine with high precision the melt profile of PCR products using a new generation of double-stranded DNA-binding dyes and accurate fluorescence data acquisition over small temperature increments (commonly in 0.2 °C increments) [10]. HRM is an ideal format for scoring a small number of SNPs, with minimal cost and time requirements for new assay development. Two standard primers are used to amplify short segments flanking each SNP. The melt profile of the resulting amplicon is characteristic of its GC content in which a substitution of a G or C to an A or T reduces the melting temperature (Tm), while a substitution of an A or T to a G or C increases the Tm. The turnaround time for a run and the follow-on data analysis requires less than 2 h. Based on its simplicity, low cost, nondestructive nature, high sensitivity, and specificity, the popularity of HRM analysis has grown considerably in the last few years.
HRM is superior in terms of cost-effectiveness, ease of use, and speed of development compared to alternative SNP-interrogation approaches on real-time technologies, i.e., dual-probe TaqMan PCR assays [11–13] and mismatch amplification mutation assays (MAMA) [14, 15]. TaqMan-minor groove-binding allelic discrimination assays can be cost-prohibitive in studies interested only in small-scale SNP screening, requiring two sequence-specific fluorescently labeled probes. Based on allele-specific (AS) primers, MAMA is another cheap technique. The labeling of AS-forward primers with distinct GC-clamp enables facile differentiation of AS-PCR products through melt curve analysis (Melt-MAMA) [14], agarose gel electrophoresis [15], or capillary electrophoresis [16]. However, MAMA traditionally suffers from high rates of assay design failures and knowledge gaps on assay robustness [15].
Here, we describe 14 monoplex and seven duplex canonical SNP-based discrimination assays that coupled with HRM analysis have the potential to differentiate Bacillus anthracis strains into 13 major sublineages or subgroups.
2 Materials
2.1 DNA Preparation
1.
2.
Control DNA(s): at least one reference strain of known canSNP genotype has to be used as melt curve standard to ensure that the correct allele is called (see Note 3 ).
3.
Sterile 0.22 μm filter units (optional). DNA suspensions can be microfiltered on 0.22 μm micro-column for 2 min at 6,000 to 10,000 × g for removal of any live forms of B. anthracis.
2.2 PCR–HRM Mix
1.
HRM Master Mix: ready-to-use reaction mixes for PCR–HRM are available from various suppliers (see Note 4 ). Store at −15 to −25 °C. Keep away from light. Once the kit is opened, avoid repeated freezing and thawing: the Master Mix may be stored up to 4 weeks at +2 to +8 °C. Commercial kits usually include 25 mM MgCl2 stock solution and a Master Mix containing Taq DNA polymerase (see Note 5 ), reaction buffer, dNTP (see Note 6 ), and HRM-compatible saturating fluorescent dye.
2.
PCR-grade H2O: ultrapure water prepared by purifying deionized water, nuclease-free.
3.
Oligonucleotide primers set (see Note 7 ): 100 μM stock solutions diluted in ultrapure water (see primer sequences in Table 1). Store at −15 to −25 °C. Primer purification by HPLC is not necessary.
Table 1
Set of 14 canonical SNPs and primer sequences
canSNP name | canSNPa location | Base change | Forward and reverse primers (5′-3′) | Size (bp) | Duplex concentration | Pair n° | |
|---|---|---|---|---|---|---|---|
A.Br.001 | BA1 | 182106 | T to C | GTGGTAAGGCAAGCGGAAC | 76 | 0.2 μM | 1 |
ACGGTTTCCCTTTATCATCG | |||||||
A.Br.002 | BA2 | 947760 | G to A | GCAGAAGGAGCAAGTAATGTTATAGGT | 62 | 0.15 μM | 2 |
CCTAAAATCGATAAAGCGACTGC | |||||||
A.Br.003 | BA3 | 1493157 | A to G | AAAGGAATTTAGATTTTCGTGTCG | 58 | 0.2 μM | 3 |
ATAAAAACCTCCTTTTTCTACCTCA | |||||||
A.Br.004 | BA4 | 3600659 | T to C | ATCGCCGTCATACTTTGGAA | 53 | 0.15 μM | 3 |
GGAATTGGTGGAGCTATGGA | |||||||
A.Br.006 | BA5 | 162509 | C to A | GCGTTTTTAAGTTCATCATACCC | 54 | 0.2 μM | 4 |
ATGTTGTTGATCATTCCATCG | |||||||
A.Br.007 | BA6 | 266439 | T to C | TTACAAGGTGGTAGTATTCGAGCTG | 67 | 0.2 μM | 4 |
TTGGTAACGAGACGATAAACTGAA | |||||||
A.Br.008 | BA7 | 3947248 | T to G | CCAAACGGTGAAAAAGTTACAAA | 80 | 0.2 μM | 5 |
GCAACTACGCTATACGTTTTAGATGG | |||||||
A.Br.009 | BA8 | 2589823 | A to G | AATCGGCCACTGTTTTTGAAC | 55 | 0.25 μM | 5 |
AGGTATATTAACTGCGGATGAT | |||||||
B.Br.001 | BA9 | 1455279 | T to C | GCACGGTCATAAAAGAAATCG | 75 | 0.2 μM | 2 |
TGTTCAAAAGGTTCGGATATGA | |||||||
B.Br.002 | BA10 | 1056740 | G to T | GCACCTTCTGTGTTCGTTGTT | 68 | 0.15 μM | 1 |
TTCACCGAATGGAGGAGAAG | |||||||
B.Br.003 | BA11 | 1494269 | G to A | ATTCGCATAGAAGCAGATGAGC | 59 | 0.2 μM | 6 |
TCAAGTTCATAACGAACCATAACG | |||||||
B.Br.004 | BA12 | 69952 | T to C | TGCTTGGGTAACCTTCTTTACTT | 62 | 0.3 μM | 6 |
AGAATAAAATGAAGATAATGACAAACG | |||||||
A/B.Br.001 | BA13 | 3697886 | A to G | ATTCCAATCGCTGCACTCTT | 59 | 0.2 μM | 7 |
CCCCGATAATTTTCACAAAGC | |||||||
A.Br.011 | BA14 | 2552486 | G to A | CGAATTCCCGCTGAAAATAA | 50 | 0.2 μM | 7 |
AAAATCGGAATTGAAGCAGGA | |||||||
2.3 Equipment
1.
A real-time PCR detection system with excellent thermal control and uniformity is important.
2.
HRM-dedicated software capable of performing melt profile normalization to discriminate the fine melt profile differences generated from small sequence variations such as SNPs.
3.
Standard swing-bucket centrifuge containing a rotor for multiwell plates.
3 Methods
3.1 Preparation of DNA Samples and Biosafety Procedures
Bacillus anthracis is a class 3 pathogen and should be manipulated in a BSL3 laboratory. All security rules and hygiene precautions should be applied during DNA preparation steps (including the elimination of infectious waste).
Viability testing should be systematically performed to assess the complete removal of live forms of B. anthracis from DNA samples so that subsequent PCR–HRM analysis could be carried out safely at lower levels of biocontainment (see Note 8 ).
3.2 Assay Design
HRM primers have been designed to amplify very small amplicons (50–80 bp) around each SNP to maximize the differences in melting temperature the SNP confers (see Note 9 ).
3.3 Real-Time PCR Amplification
1.
Using monoplex assays:
(a)
Prepare 14 distinct PCR reaction mixtures for all samples (including template and control DNAs). The total PCR volume is 10 μl per reaction (see Note 10 ).
2.
Using duplex assays:
3.
Aliquot 9 μl of each monoplex or duplex reaction mix to wells and add 1 μl of template (or control) DNA.
4.
Centrifuge the samples prior to the run to remove air bubbles.
5.
Run the amplification and HRM steps using the following thermocycling parameters: 95 °C for 10 min, followed by 35 cycles consisting of 10 s at 95 °C, 10 s at 58 °C, and 10 s at 72 °C (see Note 14 ). After an additional denaturation (at 95 °C for 1 min) and cooling (to 50 °C for 1 min) steps, melt curves are generated by heating from 65 °C to 90 °C with fluorescence data acquisition at 0.025 °C/s increments (see Note 15 ).
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
