Multiplexed Genotyping of Bacillus anthracis by Luminex xMap Suspension Array



Fig. 1
MOL-PCR general scheme





2 Materials



2.1 DNA Preparation and Biosafety Procedures




1.

Bacillus anthracis is a class 3 pathogen and should be manipulated in a BSL3 laboratory. Viability testing should be systematically performed to assess the complete removal of live forms of B. anthracis from DNA samples so that subsequent analysis could be carried out safely at lower levels of biocontainment (see Note 1 ).

 

2.

Template DNA(s): 5–10 ng genomic DNA (see Note 2 ). Use template DNA suitable for PCR in terms of purity, concentration, and absence of PCR inhibitors.

 


2.2 MOL-PCR




1.

10× Ampligase DNA Ligase Buffer (Epicentre, Madison, USA).

 

2.

Ampligase DNA Ligase, 5 U/μL (Epicentre, Madison, USA) (see Note 3 ).

 

3.

A set of 39 modular single-stranded DNA oligonucleotides (termed MOLigo probes): a pair of competing allele-specific probes (MOLigoP1) and one common probe (MOLigoP2) per canSNP (see Notes 4 and 5 ). 100 μM stock solutions diluted in ultrapure water (see oligonucleotide sequences in Table 1). The 5′-end of each MOLigoP2 probe is phosphorylated to enable covalent linkage to MOLigoP1 in the presence of DNA ligase and target DNA.


Table 1
Oligonucleotide sequences of all probes and primers used























































































































































































































































canSNP

xTAG

Allele

MOLigo

Sequence (5′-3′)a

BA1 A.Br.001

B007

C

P1

5′-ACTCGTAGGGAATAAACCGT AAATTGTGAAAGATTGTTTGTGTA CAAATTTAATCTTTAAAGGAAAIIIIIACCGAAAC-3′
 
A014

T

P1

5′-ACTCGTAGGGAATAAACCGT ATTGTGAAAGAAAGAGAAGAAATT CAAATTTAATCTTTAAAGGAAAIIIIIACCGAAAT-3′
 


P2

5’P-TTGAAGTCGATGATAAAGGGAAACCGTATTATA TCTCACTTCTTACTACCGCG-3′

BA2 A.Br.002

A021

C

P1

5′-ACTCGTAGGGAATAAACCGT ATTAAGTAAGAATTGAGAGTTTGA AGAAGGAGCAAGTAATGTTATAGIIIIIGTTTAGGC-3′
 
A022

T

P1

5′-ACTCGTAGGGAATAAACCGT GATTGATATTTGAATGTTTGTTTG AGAAGGAGCAAGTAATGTTATAGIIIIIGTTTAGGT-3′
 


P2

5’P-TGGGCGGCAGTCGCTTTATC TCTCACTTCTTACTACCGCG-3′

BA3 A.Br.003

A025

G

P1

5′-ACTCGTAGGGAATAAACCGT GTATGTTGTAATGTATTAAGAAAG TGTATAAAAACCTCCTTTTTCTIIIIIACCTCAAG-3′
 
A026

A

P1

5′-ACTCGTAGGGAATAAACCGT TTTGATTTAAGAGTGTTGAATGTA TGTATAAAAACCTCCTTTTTCTIIIIIACCTCAAA-3′
 


P2

5’P-TTGAGGTAGAAAAAGGAGGTTTTTATACAATGACA TCTCACTTCTTACTACCGCG-3′

BA4 A.Br.004

A027

T

P1

5′-ACTCGTAGGGAATAAACCGT AAGATGATAGTTAAGTGTAAGTTA GACATCGCCGTCATACTTIIIIITGGAATGT-3′
 
A028

C

P1

5′-ACTCGTAGGGAATAAACCGT GATAGATTTAGAATGAATTAAGTG GACATCGCCGTCATACTTIIIIITGGAATGC-3′
 


P2

5’P-CCCTAATCCTTCCATAGCTCCACCA TCTCACTTCTTACTACCGCG-3′

BA5 A.Br.006

B008

T

P1

5′-ACTCGTAGGGAATAAACCGT TGTAAGTGAAATAGTGAGTTATTT CGTTTTTAAGTTCATCATACCIIIIICATGCACT-3′
 
A015

G

P1

5′-ACTCGTAGGGAATAAACCGT GTTGTAAATTGTAGTAAAGAAGTA CGTTTTTAAGTTCATCATACCIIIIICATGCACG-3′
 


P2

5’P-AGGCGATGGAATGATCAACAACATATTGA TCTCACTTCTTACTACCGCG-3′

BA6 A.Br.007

A029

T

P1

5′-ACTCGTAGGGAATAAACCGT TTTAAGTGAGTTATAGAAGTAGTA AGACGATAAACTGAATAATACCIIIIIATCCTTAT-3′
 
A030

C

P1

5′-ACTCGTAGGGAATAAACCGT GTGTTATAGAAGTTAAATGTTAAG AGACGATAAACTGAATAATACCIIIIIATCCTTAC-3′
 


P2

5’P-ATTCAGCTCGAATACTACCACCTTGTAATTC TCTCACTTCTTACTACCGCG-3′

BA7 A.Br.008

B009

T

P1

5′-ACTCGTAGGGAATAAACCGT GAATTGTATAAAGTATTAGATGTG TATACGTTTTAGATGGAGATAIIIIIATTCTTCT-3′
 
A018

G

P1

5′-ACTCGTAGGGAATAAACCGT GTAATTGAATTGAAAGATAAGTGT TATACGTTTTAGATGGAGATAIIIIIATTCTTCG-3′
 


P2

5’P-CCGCTTGTTAAACGTATATTTGTAACTTTTTCAC TCTCACTTCTTACTACCGCG-3′

BA8 A.Br.009

A033

C

P1

5′-ACTCGTAGGGAATAAACCGT TATTAGAGTTTGAGAATAAGTAGT AGGTATATTAACTGCGGATGIIIIIATGCAAGC-3′
 
A034

T

P1

5′-ACTCGTAGGGAATAAACCGT TGATATAGTAGTGAAGAAATAAGT AGGTATATTAACTGCGGATGIIIIIATGCAAGT-3′
 


P2

5’P-AAAGCCGTTCAAAAACAGTGGCC TCTCACTTCTTACTACCGCG-3′

BA9 B.Br.001

A035

G

P1

5′-ACTCGTAGGGAATAAACCGT AATAAGAGAATTGATATGAAGATG CGGATATGATACCGATACCTIIIIITCTTATCC-3′
 
A036

T

P1

5′-ACTCGTAGGGAATAAACCGT TTGTGTAGTTAAGAGTTGTTTAAT CGGATATGATACCGATACCTIIIIITCTTATCT-3′
 


P2

5’P-TCTTCTATTGTACCGATTTCTTTTATGACCG TCTCACTTCTTACTACCGCG-3′

BA10 B.Br.002

A037

T

P1

5′-ACTCGTAGGGAATAAACCGT TGTATATGTTAATGAGATGTTGTA ACCTTCTGTGTTCGTTGTTAAIIIIICGTTACTT-3′
 
A038

G

P1

5′-ACTCGTAGGGAATAAACCGT AGTAAGTGTTAGATAGTATTGAAT ACCTTCTGTGTTCGTTGTTAAIIIIICGTTACTG-3′
 


P2

5’P-CTGTTCCTTTTGCAACTTCTCCTCCA TCTCACTTCTTACTACCGCG-3′

BA11 B.Br.003

A012

G

P1

5′-ACTCGTAGGGAATAAACCGT AGTAGAAAGTTGAAATTGATTATG GCATAGAAGCAGATGAGCTTAIIIIICATATCCG-3′
 
A019

A

P1

5′-ACTCGTAGGGAATAAACCGT GTGTGTTATTTGTTTGTAAAGTAT GCATAGAAGCAGATGAGCTTAIIIIICATATCCA-3′
 


P2

5’P-CTTCACGTTATGGTTCGTTATGAACTTGAG TCTCACTTCTTACTACCGCG-3′

BA12 B.Br.004

A013

A

P1

5′-ACTCGTAGGGAATAAACCGT AGTGAATGTAAGATTATGTATTTG TAAAATGAAGATAATGACAAAIIIIICGGGATGA-3′
 
A020

G

P1

5′-ACTCGTAGGGAATAAACCGT AAATTAGTTGAAAGTATGAGAAAG TAAAATGAAGATAATGACAAAIIIIICGGGATGG-3′
 


P2

5’P-TAGAAGTAAAGAAGGTTACCCAAGCACTTG TCTCACTTCTTACTACCGCG-3′

BA14 A.Br.011

A039

T

P1

5′-ACTCGTAGGGAATAAACCGT TTGTGATAGTAGTTAGATATTTGT TTGAAGCAGGAIIIIIGCGCCCCT-3′
 
A042

C

P1

5′-ACTCGTAGGGAATAAACCGT ATTTGTTATGATAAATGTGTAGTG TTGAAGCAGGAIIIIIGCGCCCCC-3′
 

Only gold members can continue reading. Log In or Register to continue

Mar 17, 2017 | Posted by in GENERAL | Comments Off on Multiplexed Genotyping of Bacillus anthracis by Luminex xMap Suspension Array
Premium Wordpress Themes by UFO Themes